NEET 2023 Question PaperPhysics, Chemistry and Biology, with checked answers and solutions
By the RankUp team, founded by Dr. Deepak Sahu (MBBS Gold Medalist, NEET PG AIR 1731) · Updated
179 questions from the NEET 2023 paper, conducted by NTA. Tap an option to check your answer and read why it is right. Each subject has a free PDF with the answer key and explanations.
- Exam
- NEET 2023
- Conducted by
- NTA
- Physics
- 40 questions
- Chemistry
- 42 questions
- Biology
- 97 questions
NEET 2023 Physics questions
39 questions. Tap an option to check your answer.
Q1NEET 2023
In a series LCR circuit, the inductance L is 10 mH, capacitance C is 1 μF and resistance R is 100 Ω. The frequency at which resonance occurs is :-
Not quite — the answer is C.
f = 1/(2π√(LC)) = 1/(2π√(10⁻² × 10⁻⁶)) = 1/(2π × 10⁻⁴) ≈ 1592 Hz ≈ 1.59 kHz. The angular frequency would be 10⁴ rad/s, so the rad/s options are wrong in magnitude.
Q2NEET 2023
The ratio of radius of gyration of a solid sphere of mass M and radius R about its own axis to the radius of gyration of the thin hollow sphere of same mass and radius about its axis is :-
Not quite — the answer is D.
k_solid = √(2/5) R and k_hollow = √(2/3) R, so the ratio = √(3/5) = √3 : √5. The ratio of moments of inertia (3 : 5) is not the ratio of radii of gyration.
Q3NEET 2023
A Carnot engine has an efficiency of 50% when its source is at a temperature 327°C. The temperature of the sink is :-
Not quite — the answer is D.
η = 1 − T₂/T₁ with T₁ = 600 K: 0.5 = 1 − T₂/600, so T₂ = 300 K = 27°C. Using Celsius directly would wrongly give 163.5°C.
Q4NEET 2023
A bullet is fired from a gun at the speed of 280 m s⁻¹ in the direction 30° above the horizontal. The maximum height attained by the bullet is (g = 9.8 m s⁻², sin 30° = 0.5):-
Not quite — the answer is B.
H = (u sin θ)²/(2g) = (280 × 0.5)²/(2 × 9.8) = 19600/19.6 = 1000 m. Forgetting to square sin θ would give 2000 m.
Q5NEET 2023
An electric dipole is placed at an angle of 30° with an electric field of intensity 2 × 10⁵ N C⁻¹. It experiences a torque equal to 4 N m. Calculate the magnitude of charge on the dipole, if the dipole length is 2 cm.
Not quite — the answer is C.
τ = q(2a)E sin θ, so q = 4/(0.02 × 2 × 10⁵ × 0.5) = 4/2000 = 2 × 10⁻³ C = 2 mC. Omitting sin 30° gives 1 mC, and doubling it wrongly gives 4 mC.
Q6NEET 2023
Given below are two statements: Statement I : Photovoltaic devices can convert optical radiation into electricity. Statement II : Zener diode is designed to operate under reverse bias in breakdown region. In the light of the above statements, choose the most appropriate answer from the options given below :
Not quite — the answer is D.
Solar cells (photovoltaic devices) generate an emf when light falls on them, and a Zener diode is a heavily doped diode made to work in reverse breakdown as a voltage regulator. Both statements are correct.
Q7NEET 2023
The errors in the measurement which arise due to unpredictable fluctuations in temperature and voltage supply are :
Not quite — the answer is C.
Errors from irregular, unpredictable changes in experimental conditions such as temperature or supply voltage are random errors. Instrumental errors are systematic and come from imperfect instruments.
Q8NEET 2023
The ratio of frequencies of fundamental harmonic produced by an open pipe to that of closed pipe having the same length is
Not quite — the answer is A.
Open pipe: f = v/2L; closed pipe: f = v/4L. Their ratio is 2 : 1. The inverted ratio 1 : 2 compares closed to open.
Q9NEET 2023
The net magnetic flux through any closed surface is :
Not quite — the answer is D.
Gauss's law for magnetism: magnetic monopoles do not exist and field lines form closed loops, so as many lines leave a closed surface as enter it and the net flux is zero.
Q10NEET 2023
The work functions of Caesium (Cs), potassium (K) and Sodium (Na) are 2.14 eV, 2.30 eV and 2.75 eV respectively. If incident electromagnetic radiation has an incident energy of 2.20 eV, which of these photosensitive surfaces may emit photoelectrons?
Not quite — the answer is D.
Emission needs photon energy ≥ work function. 2.20 eV exceeds only caesium's 2.14 eV; it is below potassium's 2.30 eV and sodium's 2.75 eV.
Q11NEET 2023
The minimum wavelength of X-rays produced by an electron accelerated through a potential difference of V volts is proportional to :
Not quite — the answer is A.
The shortest wavelength arises when all the electron's energy eV goes into one photon: eV = hc/λ_min, so λ_min ∝ 1/V. The 1/√V dependence is for the electron's de Broglie wavelength, not the X-ray cut-off.
Q12NEET 2023
A 12 V, 60 W lamp is connected to the secondary of a step down transformer, whose primary is connected to ac mains of 220 V. Assuming the transformer to be ideal, what is the current in the primary winding ?
Not quite — the answer is D.
For an ideal transformer input power = output power = 60 W, so I_p = 60/220 ≈ 0.27 A. The secondary current would be 60/12 = 5 A.
Q13NEET 2023
Light travels a distance x in time t₁ in air and 10x in time t₂ in another denser medium. What is the critical angle for this medium?
Not quite — the answer is C.
c = x/t₁ and v = 10x/t₂, so n = c/v = t₂/(10t₁). sin C = 1/n = 10t₁/t₂, giving C = sin⁻¹(10t₁/t₂). The expression 10t₂/t₁ is n inverted incorrectly and exceeds 1.
Q14NEET 2023
A metal wire has mass (0.4 ± 0.002) g, radius (0.3 ± 0.001) mm and length (5 ± 0.02) cm. The maximum possible percentage error in the measurement of density will nearly be :
Not quite — the answer is B.
ρ = m/(πr²L), so Δρ/ρ = Δm/m + 2Δr/r + ΔL/L = 0.002/0.4 + 2(0.001/0.3) + 0.02/5 = 0.5% + 0.67% + 0.4% ≈ 1.6%. Forgetting the factor 2 for the radius gives about 1.2%.
Q15NEET 2023
For Young's double slit experiment, two statements are given below : Statement I : If screen is moved away from the plane of slits, angular separation of the fringes remains constant. Statement II : If the monochromatic source is replaced by another monochromatic source of larger wavelength, the angular separation of fringes decreases. In the light of the above statements, choose the correct answer from the options given below :
Not quite — the answer is B.
Angular fringe separation is λ/d, independent of the screen distance D, so Statement I is true. A larger λ increases λ/d, so Statement II is false.
Q16NEET 2023
Resistance of a carbon resistor determined from colour codes is (22000 ± 5%) Ω. The colour of third band must be :
Not quite — the answer is B.
22000 Ω = 22 × 10³ Ω: the first two bands are red-red (2, 2) and the third, the multiplier 10³, is orange; gold gives ±5%. Red as the third band would mean 2200 Ω.
Q17NEET 2023
An ac source is connected to a capacitor C. Due to decrease in its operating frequency
Not quite — the answer is B.
X_C = 1/(2πfC) increases as f decreases, so the current through the circuit, which in the gap of the capacitor is the displacement current, decreases. Capacitive reactance therefore rises, not falls or stays constant.
Q18NEET 2023
A vehicle travels half the distance with speed v and the remaining distance with speed 2v. Its average speed is :
Not quite — the answer is B.
For equal distances, v_avg = 2v₁v₂/(v₁ + v₂) = 2(v)(2v)/(3v) = 4v/3. The arithmetic mean 3v/2 would apply only for equal times.
Q19NEET 2023
The amount of energy required to form a soap bubble of radius 2 cm from a soap solution is nearly: (surface tension of soap solution = 0.03 N m⁻¹)
Not quite — the answer is B.
A soap bubble has two surfaces, so W = T × 2 × 4πr² = 0.03 × 8π × (0.02)² = 0.03 × 1.005 × 10⁻² ≈ 3.01 × 10⁻⁴ J. Counting only one surface gives about 1.5 × 10⁻⁴ J.
Q20NEET 2023
The venturi-meter works on :
Not quite — the answer is A.
A venturimeter measures flow speed from the pressure drop at its constriction, which follows from Bernoulli's principle with the continuity equation. The axis theorems concern moments of inertia and Huygens' principle concerns wavefronts.
Q21NEET 2023
In hydrogen spectrum, the shortest wavelength in the Balmer series is λ. The shortest wavelength in the Brackett series is :
Not quite — the answer is A.
The series limit has 1/λ = R/n²: Balmer (n = 2) gives 1/λ = R/4 and Brackett (n = 4) gives R/16. So the Brackett limit is 16/4 = 4 times λ. Taking 16λ ignores that λ already contains the factor 4.
Q22NEET 2023
The potential energy of a long spring when stretched by 2 cm is U. If the spring is stretched by 8 cm, potential energy stored in it will be :
Not quite — the answer is C.
U = ½kx², so increasing x from 2 cm to 8 cm (4 times) multiplies U by 4² = 16. 4U would be the result of a linear dependence.
Q23NEET 2023
A full wave rectifier circuit consists of two p-n junction diodes, a centre-tapped transformer, capacitor and a load resistance. Which of these components remove the ac ripple from the rectified output?
Not quite — the answer is B.
The capacitor across the load charges at the peaks and discharges slowly between them, filtering out the ripple. The diodes only rectify, turning ac into pulsating dc.
Q24NEET 2023
The magnetic energy stored in an inductor of inductance 4 μH carrying a current of 2 A is :
Not quite — the answer is C.
U = ½LI² = ½ × 4 × 10⁻⁶ × 2² = 8 × 10⁻⁶ J = 8 μJ. The milli-joule options use the wrong prefix.
Q25NEET 2023
If ∮ₛ E⃗·dS⃗ = 0 over a surface, then:
Not quite — the answer is D.
Zero net flux means the enclosed charge is zero, i.e. as many field lines enter the closed surface as leave it. It says nothing about the field being constant or uniform; outside charges can still produce a non-zero, varying field on the surface.
Q26NEET 2023
A football player is moving southward and suddenly turns eastward with the same speed to avoid an opponent. The force that acts on the player while turning is :
Not quite — the answer is B.
Δv = v(east) − v(south) = v(east) + v(north), which points north-east; the force is along the change in momentum, hence north-east. Eastward is the final velocity, not the change in velocity.
Q27NEET 2023
Let a wire be suspended from the ceiling (rigid support) and stretched by a weight W attached at its free end. The longitudinal stress at any point of cross-sectional area A of the wire is :
Not quite — the answer is A.
Treating the wire as light, the tension is W at every cross-section, so the longitudinal stress is force per area = W/A. The ceiling reaction does not double it.
Q28NEET 2023
The angular acceleration of a body, moving along the circumference of a circle, is :
Not quite — the answer is C.
Angular velocity and angular acceleration are axial vectors directed along the axis of rotation (by the right-hand rule). Centripetal acceleration points towards the centre and tangential acceleration along the tangent, but those are linear accelerations.
Q29NEET 2023
In a plane electromagnetic wave travelling in free space, the electric field component oscillates sinusoidally at a frequency of 2.0 × 10¹⁰ Hz and amplitude 48 V m⁻¹. Then the amplitude of oscillating magnetic field is : (Speed of light in free space = 3 × 10⁸ m s⁻¹)
Not quite — the answer is B.
B₀ = E₀/c = 48/(3 × 10⁸) = 1.6 × 10⁻⁷ T; the frequency is not needed. The other options are off by powers of ten.
Q30NEET 2023
Two bodies of mass m and 9m are placed at a distance R. The gravitational potential on the line joining the bodies where the gravitational field equals zero, will be (G = gravitational constant) :
Not quite — the answer is B.
At the null point, Gm/x² = G(9m)/(R − x)², so R − x = 3x and x = R/4. V = −Gm/(R/4) − 9Gm/(3R/4) = −4Gm/R − 12Gm/R = −16Gm/R. Potential is a scalar, so both contributions add even though the fields cancel.
Q31NEET 2023
Calculate the maximum acceleration of a moving car so that a body lying on the floor of the car remains stationary. The coefficient of static friction between the body and the floor is 0.15 (g = 10 m s⁻²).
Not quite — the answer is B.
Static friction must supply ma, and its maximum is μmg, so a_max = μg = 0.15 × 10 = 1.5 m s⁻². Multiplying μ by 1000 or dividing wrongly gives the other values.
Q32NEET 2023
A satellite is orbiting just above the surface of the earth with period T. If d is the density of the earth and G is the universal constant of gravitation, the quantity 3π/(Gd) represents :
Not quite — the answer is A.
T = 2π√(R³/GM) with M = (4/3)πR³d gives T² = 4π²R³/(G·(4/3)πR³d) = 3π/(Gd). So 3π/(Gd) equals T², not T.
Q33NEET 2023
A horizontal bridge is built across a river. A student standing on the bridge throws a small ball vertically upwards with a velocity 4 m s⁻¹. The ball strikes the water surface after 4 s. The height of bridge above water surface is (Take g = 10 m s⁻²)
Not quite — the answer is B.
Taking up as positive, displacement = ut − ½gt² = 4 × 4 − ½ × 10 × 16 = 16 − 80 = −64 m, so the bridge is 64 m above the water. Ignoring the initial upward velocity's sign gives 96 m or 80 m, not 64 m.
Q34NEET 2023
Two thin lenses are of same focal lengths (f), but one is convex and the other one is concave. When they are placed in contact with each other, the equivalent focal length of the combination will be :
Not quite — the answer is C.
1/F = 1/f + 1/(−f) = 0, so the combination has zero power and an infinite focal length; it behaves like a plane glass plate.
Q35NEET 2023
A wire carrying a current I along the positive x-axis has length L. It is kept in a magnetic field B⃗ = (2î + 3ĵ − 4k̂) T. The magnitude of the magnetic force acting on the wire is :
Not quite — the answer is B.
F⃗ = IL î × (2î + 3ĵ − 4k̂) = IL(3k̂ + 4ĵ), since î × î = 0. |F| = IL√(3² + 4²) = 5IL. Using the full |B| = √29 would wrongly include the component parallel to the wire.
Q36NEET 2023
A bullet from a gun is fired on a rectangular wooden block with velocity u. When bullet travels 24 cm through the block along its length horizontally, velocity of bullet becomes u/3. Then it further penetrates into the block in the same direction before coming to rest exactly at the other end of the block. The total length of the block is :
Not quite — the answer is D.
With uniform retardation a: u² − u²/9 = 2a(24), so 2a = u²/27 per cm. For the rest: (u/3)² = 2a·s gives s = (u²/9)/(u²/27) = 3 cm. Total length = 24 + 3 = 27 cm.
Q37NEET 2023
The resistance of platinum wire at 0°C is 2 Ω and 6.8 Ω at 80°C. The temperature coefficient of resistance of the wire is :
Not quite — the answer is B.
R_t = R₀(1 + αt): α = (6.8 − 2)/(2 × 80) = 4.8/160 = 0.03 = 3 × 10⁻² °C⁻¹. (This is far larger than platinum's real value, but it is what the given data imply.)
Q38NEET 2023
10 resistors, each of resistance R are connected in series to a battery of emf E and negligible internal resistance. Then those are connected in parallel to the same battery, the current is increased n times. The value of n is :
Not quite — the answer is A.
Series: R_s = 10R, I₁ = E/10R. Parallel: R_p = R/10, I₂ = 10E/R. n = I₂/I₁ = 100. The answer 10 forgets that resistance both rises tenfold in series and drops tenfold in parallel.
Q39NEET 2023
The radius of inner most orbit of hydrogen atom is 5.3 × 10⁻¹¹ m. What is the radius of third allowed orbit of hydrogen atom?
Not quite — the answer is C.
Bohr radius r_n = n²r₁, so r₃ = 9 × 0.53 Å = 4.77 Å. Multiplying by 3 instead of 9 gives 1.59 Å.
Physics: not in the current NEET syllabus
These 1 questions are from topics NCERT dropped in its 2023 revision. Shown for completeness; you can skip them for NEET 2027.
1 questions. Tap an option to check your answer.
Q1NEET 2023
The half life of a radioactive substance is 20 minutes. In how much time, the activity of substance drops to (1/16)th of its initial value?
Not quite — the answer is C.
1/16 = (1/2)⁴, so four half-lives are needed: 4 × 20 = 80 minutes. 60 minutes would give only 1/8 of the activity.
Chapter-wise split of NEET 2023 Physics
- Current Electricity3 Q
- Motion in a Straight Line3 Q
- Alternating Current2 Q
- System of Particles and Rotational Motion2 Q
- Electric Charges and Fields2 Q
- Semiconductor Electronics: Materials, Devices and Simple Circuits2 Q
- Units and Measurements2 Q
- Dual Nature of Radiation and Matter2 Q
- Ray Optics and Optical Instruments2 Q
- Electromagnetic Waves2 Q
- Mechanical Properties of Fluids2 Q
- Atoms2 Q
- Laws of Motion2 Q
- Gravitation2 Q
- Thermodynamics1 Q
- Motion in a Plane1 Q
- Waves1 Q
- Magnetism and Matter1 Q
- Wave Optics1 Q
- Work, Energy and Power1 Q
- Electromagnetic Induction1 Q
- Mechanical Properties of Solids1 Q
- Moving Charges and Magnetism1 Q
NEET 2023 Chemistry questions
33 questions. Tap an option to check your answer.
Q1NEET 2023
The conductivity of centimolar solution of KCl at 25°C is 0.0210 ohm⁻¹ cm⁻¹ and the resistance of the cell containing the solution at 25°C is 60 ohm. The value of cell constant is -
Not quite — the answer is B.
Cell constant G* = κ × R = 0.0210 ohm⁻¹ cm⁻¹ × 60 ohm = 1.26 cm⁻¹. Dividing instead of multiplying (or using 1/R) gives none of the other values sensibly; conductivity times resistance is the defining relation.
Q2NEET 2023
For a certain reaction, the rate = k[A]²[B], when the initial concentration of A is tripled keeping concentration of B constant, the initial rate would
Not quite — the answer is B.
The rate is second order in A, so tripling [A] multiplies the rate by 3² = 9. A factor of three would apply only if the reaction were first order in A.
Q3NEET 2023
Given below are two statements : one is labelled as Assertion A and the other is labelled as Reason R. Assertion A : Helium is used to dilute oxygen in diving apparatus. Reason R : Helium has high solubility in O₂. In the light of the above statements, choose the correct answer from the options given below:
Not quite — the answer is B.
Helium is mixed with oxygen in diving cylinders because it is only sparingly soluble in blood, avoiding the bends caused by dissolved nitrogen, so the assertion is true. The reason is false: the relevant property is helium's low solubility (in blood), not a high solubility in O₂.
Q4NEET 2023
Amongst the following, the total number of species NOT having eight electrons around central atom in its outer most shell, is NH₃, AlCl₃, BeCl₂, CCl₄, PCl₅ :
Not quite — the answer is D.
NH₃ and CCl₄ have an octet. AlCl₃ has 6 and BeCl₂ has 4 electrons around the central atom (incomplete octets), while PCl₅ has 10 (expanded octet). So three species do not have eight electrons.
Q5NEET 2023
The correct order of energies of molecular orbitals of N₂ molecule, is
Not quite — the answer is D.
For N₂ and lighter diatomics, s–p mixing raises σ2pz above the degenerate π2p pair, so the order is … σ*2s < (π2px = π2py) < σ2pz < (π*2px = π*2py) < σ*2pz. Placing σ2pz below the π2p orbitals is the order for O₂ and F₂.
Q6NEET 2023
Match List I with List II: List I: (A) Coke (B) Diamond (C) Fullerene (D) Graphite List II: (I) Carbon atoms are sp³ hybridised (II) Used as a dry lubricant (III) Used as a reducing agent (IV) Cage like molecules Choose the correct answer from the options given below:
Not quite — the answer is B.
Coke is used as a reducing agent in metallurgy, every carbon in diamond is sp³ hybridised, fullerenes are cage-like molecules such as C₆₀, and layered graphite is a dry lubricant. That gives A-III, B-I, C-IV, D-II.
Q7NEET 2023
The number of σ bonds, π bonds and lone pair of electrons in pyridine, respectively are:
Not quite — the answer is B.
Pyridine C₅H₅N has 6 ring σ bonds plus 5 C–H σ bonds = 11 σ bonds, three π bonds in the aromatic ring, and one lone pair on nitrogen. Counting 12 σ bonds wrongly adds an N–H bond that pyridine does not have.
Q8NEET 2023
The element expected to form largest ion to achieve the nearest noble gas configuration is
Not quite — the answer is B.
N³⁻, O²⁻, F⁻ and Na⁺ are isoelectronic (10 electrons); the ion with the fewest protons, N³⁻ (7 protons), holds the electrons least tightly and is largest. Na⁺ is the smallest of the set.
Q9NEET 2023
Given below are two statements: one is labelled as Assertion A and the other is labelled as Reason R. Assertion A : A reaction can have zero activation energy. Reason R : The minimum extra amount of energy absorbed by reactant molecules so that their energy becomes equal to threshold value, is called activation energy. In the light of the above statements, choose the correct answer from the options given below:
Not quite — the answer is C.
The reason is the textbook definition of activation energy: the extra energy needed to reach the threshold energy. Within the collision/Arrhenius model every reaction needs some threshold to be crossed, so the assertion that activation energy can be zero is taken as false.
Q10NEET 2023
Consider the following reaction and identify the product (P). CH₃–CH(CH₃)–CH(OH)–CH₃ (3-Methylbutan-2-ol) —HBr→ Product (P)
Not quite — the answer is D.
Protonation and loss of water give a secondary carbocation at C-2, which undergoes a 1,2-hydride shift to the more stable tertiary carbocation at C-3; Br⁻ then attacks it, giving 2-bromo-2-methylbutane. The unrearranged 2-bromo-3-methylbutane ignores this rearrangement.
Q11NEET 2023
Given below are two statements: one is labelled as Assertion A and the other is labelled as Reason R: Assertion A : In equation Δ_rG = −nFE_cell, value of Δ_rG depends on n. Reason R : E_cell is an intensive property and Δ_rG is an extensive property. In the light of the above statements, choose the correct answer from the options given below:
Not quite — the answer is D.
E_cell is intensive (independent of how much reaction is written), whereas Δ_rG is extensive and scales with the amount, which enters through n, the number of electrons transferred. So Δ_rG depends on n precisely because it is extensive while E_cell is not; both are true and the reason explains the assertion.
Q12NEET 2023
In Lassaigne's extract of an organic compound, both nitrogen and sulphur are present, which gives blood red colour with Fe³⁺ due to the formation of-
Not quite — the answer is C.
When both N and S are present, fusion with sodium gives NaSCN, and the thiocyanate ion reacts with Fe³⁺ to give the blood-red complex [Fe(SCN)]²⁺. NaSCN itself is colourless, and Prussian blue indicates nitrogen alone.
Q13NEET 2023
Identify the product in the following reaction: C₆H₅N₂⁺Cl⁻ —(i) Cu₂Br₂/HBr; (ii) Mg/dry ether; (iii) H₂O→ Product
Not quite — the answer is A.
Sandmeyer reaction converts benzenediazonium chloride to bromobenzene; Mg in dry ether gives phenylmagnesium bromide, which is protonated by water to benzene. Phenylmagnesium bromide is only the intermediate, and phenol would need warm water on the diazonium salt.
Q14NEET 2023
Select the correct Statements from the following : A. Atoms of all elements are composed of two fundamental particles. B. The mass of the electron is 9.10939 × 10⁻³¹ kg. C. All the isotopes of a given elements show same chemical properties. D. Protons and electrons are collectively known as nucleons. E. Dalton's atomic theory, regarded the atom as an ultimate particle of matter. Choose the correct answer from the options given below.
Not quite — the answer is C.
The electron mass is 9.10939 × 10⁻³¹ kg, isotopes have the same electron configuration and hence the same chemistry, and Dalton treated the atom as indivisible, so B, C and E are correct. Atoms contain three fundamental particles, and nucleons are protons and neutrons, not protons and electrons.
Q15NEET 2023
Given below are two statements: Statement I : A unit formed by the attachment of a base to 1' position of sugar is known as nucleoside Statement II : When nucleoside is linked to phosphorous acid at 5' position of sugar moiety, we get nucleotide. In the light of the above statements, choose the correct answer from the options given below:
Not quite — the answer is B.
A base attached at C-1′ of the pentose is a nucleoside, so Statement I is true. A nucleotide is formed when the nucleoside is esterified with phosphoric acid (H₃PO₄) at C-5′, not phosphorous acid, so Statement II is false.
Q16NEET 2023
Taking stability as the factor, which one of the following represents correct relationship?
Not quite — the answer is C.
Down group 13 the inert pair effect makes the +1 state more stable than +3 for thallium, so TlI is more stable than TlI₃. For aluminium the +3 state is the stable one, and for Tl the chloride TlCl₃ is less stable than TlCl.
Q17NEET 2023
Intermolecular forces are forces of attraction and repulsion between interacting particles that will include: A. dipole - dipole forces. B. dipole - induced dipole forces C. hydrogen bonding D. covalent bonding E. dispersion forces Choose the most appropriate answer from the options given below :
Not quite — the answer is B.
Dipole–dipole, dipole–induced dipole, hydrogen bonding and London dispersion forces all act between molecules. Covalent bonding holds atoms together within a molecule, so it is an intramolecular force and must be excluded.
Q18NEET 2023
Amongst the given options which of the following molecules/ion acts as a Lewis acid?
Not quite — the answer is B.
BF₃ has an incomplete octet on boron and accepts an electron pair, so it is a Lewis acid. H₂O, OH⁻ and NH₃ all carry lone pairs that they donate, making them Lewis bases.
Q19NEET 2023
The right option for the mass of CO₂ produced by heating 20 g of 20% pure limestone is (Atomic mass of Ca = 40) [CaCO₃ —1200 K→ CaO + CO₂]
Not quite — the answer is A.
Pure CaCO₃ = 20 % of 20 g = 4 g = 4/100 = 0.04 mol, which gives 0.04 mol CO₂ = 0.04 × 44 = 1.76 g. The trap is ignoring the 20 % purity: the full 20 g would give 8.8 g of CO₂, and 1.12 g would correspond to only 2.55 g of CaCO₃.
Q20NEET 2023
The relation between n_m, (n_m = the number of permissible values of magnetic quantum number (m)) for a given value of azimuthal quantum number (l), is
Not quite — the answer is D.
For a given l, m runs from −l to +l, so n_m = 2l + 1, which rearranges to l = (n_m − 1)/2. The relation l = 2n_m + 1 has the roles of l and n_m swapped.
Q21NEET 2023
The stability of Cu²⁺ is more than Cu⁺ salts in aqueous solution due to -
Not quite — the answer is B.
The much more negative hydration enthalpy of the small, doubly charged Cu²⁺ ion more than compensates for the second ionisation enthalpy of copper, so Cu²⁺ is more stable in water and Cu⁺ disproportionates. The second ionisation enthalpy works against Cu²⁺, so it cannot be the reason.
Q22NEET 2023
Which of the following reactions will NOT give primary amine as the product?
Not quite — the answer is B.
Reduction of methyl isocyanide gives N-methylmethanamine, CH₃NHCH₃, a secondary amine. Reduction of the nitrile or the amide gives ethanamine, and the Hofmann bromamide reaction gives methanamine, both primary amines.
Q23NEET 2023
The given compound C₆H₅–CH=CH–CH(X)–CH₂CH₃ is an example of ________.
Not quite — the answer is B.
The halogen is on an sp³ carbon directly attached to a C=C double bond, which makes it an allylic halide. It is not benzylic because the carbon bearing X is not bonded to the ring, and not vinylic because X is not on a doubly bonded carbon.
Q24NEET 2023
Homoleptic complex from the following complexes is :
Not quite — the answer is D.
A homoleptic complex has only one kind of ligand; K₃[Al(C₂O₄)₃] contains only oxalate ligands. Each of the others has two or more different ligands (ammine with chlorido/nitrito, carbonato or aqua).
Q25NEET 2023
Consider the following reaction C₆H₅–CH₂–O–C₆H₅ —HI, Δ→ A + B Identify products A and B :-
Not quite — the answer is B.
HI protonates the ether and iodide attacks the benzylic carbon (the aryl–O bond has partial double-bond character and is not cleaved), giving benzyl iodide and phenol. Iodobenzene cannot form because nucleophilic substitution at the aromatic carbon does not occur.
Q26NEET 2023
The equilibrium concentrations of the species in the reaction A + B ⇌ C + D are 2, 3, 10 and 6 mol L⁻¹, respectively at 300 K. ΔG⁰ for the reaction is (R = 2 cal/mol K)
Not quite — the answer is B.
K = (10 × 6)/(2 × 3) = 10. ΔG° = −2.303RT log K = −2.303 × 2 × 300 × 1 = −1381.8 cal. A positive value would mean K < 1, which contradicts the data.
Q27NEET 2023
Which amongst the following options is the correct relation between change in enthalpy and change in internal energy?
Not quite — the answer is A.
From H = U + PV and PV = nRT for gases, ΔH = ΔU + Δn_g RT, where Δn_g is moles of gaseous products minus gaseous reactants. The minus-sign versions reverse the sign of the PΔV work term.
Q28NEET 2023
Match List I with List II: List I (Oxoacids of Sulphur): (A) Peroxodisulphuric acid (B) Sulphuric acid (C) Pyrosulphuric acid (D) Sulphurous acid List II (Bonds): (I) Two S-OH, Four S=O, One S-O-S (II) Two S-OH, One S=O (III) Two S-OH, Four S=O, One S-O-O-S (IV) Two S-OH, Two S=O Choose the correct answer from the options given below:
Not quite — the answer is A.
H₂S₂O₈ has a peroxo S–O–O–S bridge with four S=O and two S–OH; H₂SO₄ has two S=O and two S–OH; H₂S₂O₇ has an S–O–S bridge with four S=O and two S–OH; H₂SO₃ has one S=O and two S–OH. This gives A-III, B-IV, C-I, D-II; swapping the peroxo and oxo bridges is the trap.
Q29NEET 2023
Which of the following statements are INCORRECT? A. All the transition metals except scandium form MO oxides which are ionic. B. The highest oxidation number corresponding to the group number in transition metal oxides is attained in Sc₂O₃ to Mn₂O₇. C. Basic character increases from V₂O₃ to V₂O₄ to V₂O₅. D. V₂O₄ dissolves in acids to give VO₄³⁻ salts. E. CrO is basic but Cr₂O₃ is amphoteric. Choose the correct answer from the options given below:
Not quite — the answer is B.
As the oxidation state of vanadium rises from +3 to +5, its oxides become less basic and more acidic, so C is wrong; V₂O₄ dissolves in acids to give oxovanadium(IV) VO²⁺ salts, not VO₄³⁻, so D is wrong. A, B and E are correct textbook statements.
Q30NEET 2023
Which complex compound is most stable?
Not quite — the answer is B.
Ethylenediamine is a bidentate chelating ligand, and the chelate effect makes [CoCl₂(en)₂]⁺ much more stable than the complexes with only monodentate ligands. The hexaammine complex has strong ligands but no chelate rings.
Q31NEET 2023
On balancing the given redox reaction, aCr₂O₇²⁻ + bSO₃²⁻(aq) + cH⁺(aq) → 2aCr³⁺(aq) + bSO₄²⁻(aq) + (c/2)H₂O(l) the coefficients a, b and c are found to be, respectively -
Not quite — the answer is D.
Each Cr₂O₇²⁻ gains 6 electrons (2 Cr from +6 to +3) and each SO₃²⁻ loses 2 (S from +4 to +6), so 1 Cr₂O₇²⁻ reacts with 3 SO₃²⁻. Balancing O and H gives Cr₂O₇²⁻ + 3SO₃²⁻ + 8H⁺ → 2Cr³⁺ + 3SO₄²⁻ + 4H₂O, i.e. a = 1, b = 3, c = 8.
Q32NEET 2023
Identify the final product [D] obtained in the following sequence of reactions. CH₃CHO —i) LiAlH₄, ii) H₃O⁺→ [A] —H₂SO₄, Δ→ [B] —HBr→ [C] —C₆H₅Br, Na/dry ether→ [D]
Not quite — the answer is D.
Ethanal is reduced to ethanol, dehydrated to ethene, which adds HBr to give bromoethane; Wurtz–Fittig coupling with bromobenzene and sodium gives ethylbenzene. Butane and biphenyl are only the side products of like-with-like coupling.
Q33NEET 2023
Weight (g) of two moles of the organic compound, which is obtained by heating sodium ethanoate with sodium hydroxide in presence of calcium oxide is :
Not quite — the answer is A.
Soda-lime decarboxylation: CH₃COONa + NaOH → CH₄ + Na₂CO₃ (CaO). Methane has M = 16 g/mol, so two moles weigh 32 g. Giving 16 g is the mass of one mole; 30 g would be ethane, which is not formed.
Chemistry: not in the current NEET syllabus
These 9 questions are from topics NCERT dropped in its 2023 revision. Shown for completeness; you can skip them for NEET 2027.
9 questions. Tap an option to check your answer.
Q1NEET 2023
Given below are two statements : one is labelled as Assertion A and the other is labelled as Reason R : Assertion A : Metallic sodium dissolves in liquid ammonia giving a deep blue solution, which is paramagnetic. Reason R : The deep blue solution is due to the formation of amide. In the light of the above statements, choose the correct answer from the options given below:
Not quite — the answer is B.
Sodium in liquid ammonia gives ammoniated electrons, which cause both the deep blue colour and the paramagnetism, so the assertion is true. Amide (NaNH₂) forms only slowly and makes the solution less blue, so the reason is false.
Q2NEET 2023
Which one is an example of heterogenous catalysis?
Not quite — the answer is C.
In the Haber process the gaseous reactants react on solid iron, so the catalyst is in a different phase: heterogeneous catalysis. Acid-catalysed sugar hydrolysis and the gas-phase NO-catalysed reactions have catalyst and reactants in the same phase.
Q3NEET 2023
A compound is formed by two elements A and B. The elements B forms cubic close packed structure and atoms of A occupy 1/3 of tetrahedral voids. If the formula of the compound is A_xB_y, then the value of x + y is in option
Not quite — the answer is D.
A ccp unit cell has 4 B atoms and 8 tetrahedral voids; A fills 1/3 of them = 8/3. A : B = 8/3 : 4 = 2 : 3, so the formula is A₂B₃ and x + y = 5.
Q4NEET 2023
Which amongst the following molecules on polymerization produces neoprene?
Not quite — the answer is A.
Neoprene is polychloroprene, made by polymerising chloroprene, 2-chlorobuta-1,3-diene. Isoprene (the methyl analogue) gives natural-rubber type polymer, and buta-1,3-diene is used for Buna rubbers.
Q5NEET 2023
Some tranquilizers are listed below. Which one from the following belongs to barbiturates?
Not quite — the answer is C.
Veronal (barbital) is a derivative of barbituric acid. Meprobamate is a carbamate, and Valium and chlordiazepoxide are benzodiazepines.
Q6NEET 2023
Which of the following statements are NOT correct? A. Hydrogen is used to reduce heavy metal oxides to metals. B. Heavy water is used to study reaction mechanism. C. Hydrogen is used to make saturated fats from oils D. The H – H bond dissociation enthalpy is lowest as compared to a single bond between two atoms of any element. E. Hydrogen reduces oxides of metals that are more active than iron. Choose the most appropriate answer from the options given below:
Not quite — the answer is B.
The H–H bond dissociation enthalpy (435.9 kJ/mol) is the highest for a single bond between two atoms of any element, so D is wrong; hydrogen reduces oxides of metals less active than iron, not more active ones, so E is wrong. A, B and C are correct uses of hydrogen and heavy water.
Q7NEET 2023
Given below are two statements: Statement I : The nutrient deficient water bodies lead to eutrophication. Statement II : Eutrophication leads to decrease in the level of oxygen in the water bodies. In the light of the above statements, choose the correct answer from the options given below:
Not quite — the answer is C.
Eutrophication is caused by nutrient enrichment (e.g. phosphates, nitrates), not nutrient deficiency, so Statement I is wrong. The resulting algal bloom and its decay use up dissolved oxygen, so Statement II is true.
Q8NEET 2023
The reaction that does NOT take place in blast furnace between 900 K to 1500 K temperature range during extraction of iron is :
Not quite — the answer is D.
Reduction of Fe₂O₃ by CO to FeO occurs in the cooler upper zone (about 500–800 K). In the 900–1500 K zone, CO₂ is reduced by coke to CO, FeO is reduced to iron, and lime combines with silica to form slag.
Q9NEET 2023
What fraction of one edge centred octahedral void lies in one unit cell of fcc?
Not quite — the answer is B.
An edge centre is shared by four unit cells, so only 1/4 of an edge-centred octahedral void belongs to one cell. 1/2 would be the share of a face-centred site.
Chapter-wise split of NEET 2023 Chemistry
- Chemical Bonding and Molecular Structure3 Q
- Haloalkanes and Haloarenes3 Q
- Electrochemistry2 Q
- Chemical Kinetics2 Q
- Organic Chemistry: Some Basic Principles and Techniques2 Q
- Amines2 Q
- Structure of Atom2 Q
- The d- and f-Block Elements2 Q
- Coordination Compounds2 Q
- Thermodynamics2 Q
- Classification of Elements and Periodicity in Properties1 Q
- Biomolecules1 Q
- Equilibrium1 Q
- Some Basic Concepts of Chemistry1 Q
- Alcohols, Phenols and Ethers1 Q
- Redox Reactions1 Q
- Hydrocarbons1 Q
NEET 2023 Biology questions
83 questions. Tap an option to check your answer.
Q1NEET 2023
Among ‘The Evil Quartet’, which one is considered the most important cause driving extinction of species?
Not quite — the answer is D.
Habitat loss and fragmentation is the most important of the four causes in the Evil Quartet, as seen in the clearing of tropical rain forests that destroys the homes of countless species at once. Over-exploitation, alien species invasions and co-extinctions are real causes but act on fewer species.
Q2NEET 2023
Identify the pair of heterosporous pteridophytes among the following :
Not quite — the answer is A.
Selaginella (a lycophyte) and Salvinia (a water fern) both produce two kinds of spores, small microspores and large megaspores, so both are heterosporous. Psilotum, Equisetum and Lycopodium are homosporous, so every other pair contains a homosporous genus.
Q3NEET 2023
Frequency of recombination between gene pairs on same chromosome as a measure of the distance between genes to map their position on chromosome, was used for the first time by
Not quite — the answer is B.
Alfred Sturtevant, a student of Morgan, used the frequency of recombination between gene pairs on the same chromosome as a measure of the distance between them and prepared the first chromosome maps. Morgan discovered linkage and recombination in Drosophila but did not map the genes himself.
Q4NEET 2023
What is the function of tassels in the corn cob?
Not quite — the answer is A.
In maize the tassels of the cob are the long styles and stigmas, which wave in the wind and trap airborne pollen grains, an adaptation for wind pollination. They do not disperse pollen (that is done by the male inflorescence) and wind-pollinated flowers do not need to attract insects.
Q5NEET 2023
Identify the correct statements : A. Detritivores perform fragmentation. B. The humus is further degraded by some microbes during mineralization. C. Water soluble inorganic nutrients go down into the soil and get precipitated by a process called leaching. D. The detritus food chain begins with living organisms. E. Earthworms break down detritus into smaller particles by a process called catabolism. Choose the correct answer from the options given below :
Not quite — the answer is D.
Detritivores such as earthworms do fragmentation, humus is further degraded by microbes during mineralization, and water-soluble inorganic nutrients going down into the soil and getting precipitated is leaching, so these three are correct. The detritus food chain begins with dead organic matter, not living organisms, and breaking detritus into smaller particles is fragmentation, not catabolism.
Q6NEET 2023
The process of appearance of recombination nodules occurs at which sub stage of prophase I in meiosis?
Not quite — the answer is A.
Recombination nodules, the sites where crossing over between non-sister chromatids occurs, appear during pachytene, after synapsis is completed in zygotene. Diplotene shows chiasmata after the synaptonemal complex dissolves, and diakinesis shows terminalisation.
Q7NEET 2023
Which of the following stages of meiosis involves division of centromere?
Not quite — the answer is B.
In anaphase II the centromere of each chromosome splits, so that the sister chromatids separate and move to opposite poles. In anaphase I only homologous chromosomes separate, with their centromeres intact, and metaphase stages only align chromosomes.
Q8NEET 2023
During the purification process for recombinant DNA technology, addition of chilled ethanol precipitates out
Not quite — the answer is A.
After the cell is lysed and RNA, proteins and other molecules are removed with enzymes, adding chilled ethanol makes the purified DNA come out of solution as fine threads. RNA is removed earlier by ribonuclease, and histones are removed by protease.
Q9NEET 2023
Family Fabaceae differs from Solanaceae and Liliaceae. With respect to the stamens, pick out the characteristics specific to family Fabaceae but not found in Solanaceae or Liliaceae.
Not quite — the answer is D.
Fabaceae has ten stamens in two bundles (9 + 1), the diadelphous condition, with dithecous anthers. Solanaceae has epipetalous stamens and Liliaceae has epiphyllous (epitepalous) stamens, and polyadelphous or monothecous conditions are found in other families such as citrus and China rose.
Q10NEET 2023
Large, colourful, fragrant flowers with nectar are seen in
Not quite — the answer is D.
Insect-pollinated flowers are generally large, colourful and fragrant and rich in nectar, which attracts the insects that carry the pollen. Wind-pollinated flowers are small, dull and without nectar or scent.
Q11NEET 2023
Spraying of which of the following phytohormone on juvenile conifers helps hastening the maturity period, that leads early seed production?
Not quite — the answer is A.
Spraying gibberellins on juvenile conifers hastens their maturity period and so leads to early seed production. Zeatin is a cytokinin, abscisic acid promotes dormancy, and indole-3-butyric acid is an auxin used mainly for rooting cuttings.
Q12NEET 2023
Among eukaryotes, replication of DNA takes place in :
Not quite — the answer is A.
DNA replication takes place in the S (synthesis) phase of interphase, when the DNA content doubles from 2C to 4C. G1 and G2 are growth phases on either side of S, and M phase is the actual division.
Q13NEET 2023
How many ATP and NADPH₂ are required for the synthesis of one molecule of Glucose during Calvin cycle?
Not quite — the answer is A.
Fixing one CO₂ in the Calvin cycle needs 3 ATP and 2 NADPH, and a glucose molecule needs six turns of the cycle, so 6 × 3 = 18 ATP and 6 × 2 = 12 NADPH are used. The other combinations do not match these 3:2 per-CO₂ requirements.
Q14NEET 2023
In gene gun method used to introduce alien DNA into host cells, microparticles of ________ metal are used.
Not quite — the answer is B.
In the biolistic or gene gun method, cells are bombarded with high-velocity microparticles of gold or tungsten coated with DNA. These dense, inert metals carry the DNA into the cell, while zinc, silver and copper are not used.
Q15NEET 2023
Unequivocal proof that DNA is the genetic material was first proposed by
Not quite — the answer is A.
Hershey and Chase (1952) used bacteriophages labelled with radioactive phosphorus (in DNA) or sulphur (in protein) and showed that only the DNA entered the bacteria, giving the unequivocal proof that DNA is the genetic material. Griffith only showed a 'transforming principle', and Avery, MacLeod and McCarty's evidence that it was DNA was not accepted by everyone.
Q16NEET 2023
In the equation GPP – R = NPP GPP is Gross Primary Productivity NPP is Net Primary Productivity R here is __________.
Not quite — the answer is B.
Net primary productivity is gross primary productivity minus the energy the plants use up in their own respiration, so R is the respiratory loss. Respiratory quotient is a ratio of CO₂ released to O₂ used, and photosynthetically active radiation is the light input, not a loss.
Q17NEET 2023
What is the role of RNA polymerase III in the process of transcription in Eukaryotes?
Not quite — the answer is A.
In eukaryotes RNA polymerase III transcribes tRNA, 5S rRNA and snRNAs. RNA polymerase I makes the 28S, 18S and 5.8S rRNAs and RNA polymerase II makes the precursor of mRNA (hnRNA).
Q18NEET 2023
In angiosperm, the haploid, diploid and triploid structures of a fertilized embryo sac sequentially are :
Not quite — the answer is B.
In the fertilised embryo sac the synergids are haploid (n), the zygote formed by syngamy is diploid (2n), and the primary endosperm nucleus formed by triple fusion is triploid (3n). Antipodals are haploid and polar nuclei are haploid each, so the other sequences put the wrong ploidy in place.
Q19NEET 2023
The phenomenon of pleiotropism refers to
Not quite — the answer is B.
Pleiotropy is when a single gene affects several phenotypic traits, as in phenylketonuria where one mutant gene causes mental retardation and reduced hair and skin pigmentation. Many genes controlling one trait is polygenic inheritance, and several alleles of one gene is multiple allelism.
Q20NEET 2023
Given below are two statements : One is labelled as Assertion A and the other is labelled as Reason R : Assertion A : ATP is used at two steps in glycolysis. Reason R : First ATP is used in converting glucose into glucose-6-phosphate and second ATP is used in conversion of fructose-6-phosphate into fructose-1, 6-diphosphate. In the light of the above statements, choose the correct answer from the options given below :
Not quite — the answer is D.
Glycolysis uses ATP at two steps: when glucose is phosphorylated to glucose-6-phosphate and when fructose-6-phosphate is phosphorylated to fructose-1,6-bisphosphate. The reason names exactly these two steps, so it correctly explains the assertion.
Q21NEET 2023
Cellulose does not form blue colour with Iodine because
Not quite — the answer is B.
Starch forms helical secondary structures that can hold iodine molecules, giving a blue colour. Cellulose is a straight-chain polymer of glucose without such complex helices, so it cannot hold iodine. Cellulose is a polysaccharide, not a disaccharide.
Q22NEET 2023
Which hormone promotes internode/petiole elongation in deep water rice?
Not quite — the answer is B.
Ethylene promotes rapid internode and petiole elongation in deep-water rice plants, which keeps their leaves and upper parts above the water. GA₃ causes stem elongation in general, but this specific response of deep-water rice is due to ethylene.
Q23NEET 2023
Expressed Sequence Tags (ESTs) refers to
Not quite — the answer is D.
In the Human Genome Project one approach identified all the genes that are expressed as RNA, and these are called Expressed Sequence Tags (ESTs). The other approach, sequence annotation, sequences the whole genome whether coding or not. ESTs are not limited to genes expressed as proteins.
Q24NEET 2023
Upon exposure to UV radiation, DNA stained with ethidium bromide will show
Not quite — the answer is C.
Ethidium bromide intercalates into DNA, and when the gel is exposed to UV light the DNA bands show a bright orange colour. That is how separated DNA fragments are seen after agarose gel electrophoresis.
Q25NEET 2023
The historic Convention on Biological Diversity, ‘The Earth Summit’ was held in Rio de Janeiro in the year
Not quite — the answer is A.
The Earth Summit on biological diversity was held in Rio de Janeiro in 1992, where nations were asked to take measures to conserve biodiversity. 2002 was the World Summit on Sustainable Development in Johannesburg.
Q26NEET 2023
The reaction centre in PS II has an absorption maxima at
Not quite — the answer is D.
The reaction centre chlorophyll a of photosystem II absorbs maximally at 680 nm and is called P680. The reaction centre of photosystem I absorbs at 700 nm (P700).
Q27NEET 2023
Given below are two statements : One labelled as Assertion A and the other labelled as Reason R: Assertion A : The first stage of gametophyte in the life cycle of moss is protonema stage. Reason R : Protonema develops directly from spores produced in capsule. In the light of the above statements, choose the most appropriate answer from options given below:
Not quite — the answer is D.
In mosses the spore germinates to form the protonema, a creeping green filamentous stage, which is the first stage of the gametophyte. The protonema develops directly from the spore, so the reason is true and explains why it is the first stage.
Q28NEET 2023
In tissue culture experiments, leaf mesophyll cells are put in a culture medium to form callus. This phenomenon may be called as
Not quite — the answer is A.
Mesophyll cells are already differentiated and have lost the ability to divide; when they regain that ability and form an undifferentiated callus in culture, the process is dedifferentiation. Differentiation is the opposite change, from meristematic to mature cells.
Q29NEET 2023
Given below are two statements : Statement I : Endarch and exarch are the terms often used for describing the position of secondary xylem in the plant body. Statement II : Exarch condition is the most common feature of the root system. In the light of the above statements, choose the correct answer from the options given below:
Not quite — the answer is C.
Endarch and exarch describe the position of protoxylem in the primary xylem, not the secondary xylem, so the first statement is incorrect. In roots the protoxylem lies towards the periphery, so the exarch condition is typical of roots and the second statement is true.
Q30NEET 2023
Match List I with List II: List I List II (A) M Phase (I) Proteins are synthesized (B) G₂ Phase (II) Inactive phase (C) Quiescent stage (III) Interval between mitosis and initiation of DNA replication (D) G₁ Phase (IV) Equational division Choose the correct answer from the options given below :
Not quite — the answer is B.
M phase is the equational division, G₂ is the phase in which proteins are synthesised in preparation for mitosis, the quiescent stage (G₀) is an inactive phase, and G₁ is the interval between mitosis and the start of DNA replication. The trap is to swap G₁ and G₂, but replication starts only after G₁.
Q31NEET 2023
Which of the following statements are correct about Klinefelter’s Syndrome? A. This disorder was first described by Langdon Down (1866). B. Such an individual has overall masculine development. However, the feminine development is also expressed. C. The affected individual is short statured. D. Physical, psychomotor and mental development is retarded. E. Such individuals are sterile. Choose the correct answer from the options given below :
Not quite — the answer is B.
Klinefelter's syndrome (47, XXY) shows overall masculine development with some feminine features such as enlarged breasts (gynaecomastia), and the individuals are sterile. Langdon Down described Down's syndrome, whose patients are short-statured with retarded physical, psychomotor and mental development, so those statements do not fit Klinefelter's syndrome.
Q32NEET 2023
Given below are two statements: Statement I : Gause’s ‘Competitive Exclusion Principle’ states that two closely related species competing for the same resources cannot co-exist indefinitely and competitively inferior one will be eliminated eventually. Statement II : In general, carnivores are more adversely affected by competition than herbivores. In the light of the above statements, choose the correct answer from the options given below:
Not quite — the answer is B.
Gause's competitive exclusion principle says two closely related species competing for the same limiting resource cannot co-exist indefinitely and the weaker one is eliminated, so the first statement is correct. In general herbivores and plants are more adversely affected by competition than carnivores, so the second statement is false.
Q33NEET 2023
How many different proteins does the ribosome consist of?
Not quite — the answer is D.
The ribosome is made of structural RNAs and about 80 different proteins. The two subunits are often confused with these counts, but 60 and 40 refer to the S values of the eukaryotic subunits (60S and 40S), not to numbers of proteins.
Q34NEET 2023
Which of the following combinations is required for chemiosmosis?
Not quite — the answer is D.
Chemiosmosis needs a membrane, a proton pump, a proton gradient across that membrane, and ATP synthase through which protons flow back to make ATP. NADP synthase is not part of it, and the gradient is of protons, not electrons.
Q35NEET 2023
Match List I with List II: List I (Interaction) – List II (Species A and B) (A) Mutualism (I) +(A), 0(B) (B) Commensalism (II) –(A), 0(B) (C) Amensalism (III) +(A), –(B) (D) Parasitism (IV) +(A), +(B) Choose the correct answer from the options given below:
Not quite — the answer is A.
Mutualism benefits both species (+, +), commensalism benefits one with no effect on the other (+, 0), amensalism harms one with no effect on the other (–, 0) and parasitism benefits the parasite and harms the host (+, –). The trap is to give amensalism the (+, 0) sign of commensalism.
Q36NEET 2023
Match List I with List II: List I List II (A) Oxidative decarboxylation (I) Citrate synthase (B) Glycolysis (II) Pyruvate dehydrogenase (C) Oxidative phosphorylation (III) Electron transport system (D) Tricarboxylic acid cycle (IV) EMP pathway Choose the correct answer from the options given below :
Not quite — the answer is C.
Oxidative decarboxylation of pyruvate is catalysed by pyruvate dehydrogenase, glycolysis is the EMP pathway, oxidative phosphorylation is linked to the electron transport system, and the TCA cycle starts with citrate synthase. The trap is to link citrate synthase to oxidative phosphorylation.
Q37NEET 2023
Given below are two statements : One labelled as Assertion A and the other labelled as Reason R : Assertion A : In gymnosperms the pollen grains are released from the microsporangium and carried by air currents. Reason R : Air currents carry the pollen grains to the mouth of the archegonia where the male gametes are discharged and pollen tube is not formed. In the light of the above statements, choose the correct answer from the options given below :
Not quite — the answer is B.
In gymnosperms the pollen grains are released from the microsporangium and carried by air currents to the ovule, so the assertion is true. The pollen then forms a pollen tube that carries the male gametes towards the archegonia, so the reason that no pollen tube forms is false.
Q38NEET 2023
Given below are two statements : One is labelled as Assertion A and the other is labelled as Reason R : Assertion A : A flower is defined as modified shoot wherein the shoot apical meristem changes to floral meristem. Reason R : Internode of the shoot gets condensed to produce different floral appendages laterally at successive node instead of leaves. In the light of the above statements, choose the correct answer from the options given below :
Not quite — the answer is D.
A flower is a modified shoot in which the shoot apical meristem changes into a floral meristem. The internodes do not elongate and the axis gets condensed, so the floral appendages arise laterally at successive nodes instead of leaves; this is what makes the flower a modified shoot.
Q39NEET 2023
Malonate inhibits the growth of pathogenic bacteria by inhibiting the activity of
Not quite — the answer is D.
Malonate closely resembles succinate in structure and competes for the active site of succinic dehydrogenase, a classic example of competitive inhibition. It does not act on amylase, lipase or dinitrogenase.
Q40NEET 2023
Given below are two statements: Statement I: A protein is imagined as a line, the left end represented by first amino acid (C-terminal) and the right end represented by last amino acid (N-terminal). Statement II: Adult human haemoglobin, consists of 4 subunits (two subunits of α type and two subunits of β type.) In the light of the above statements, choose the correct answer from the options given below:
Not quite — the answer is C.
A protein is imagined as a line whose left end is the first amino acid, the N-terminal, and whose right end is the last amino acid, the C-terminal, so the first statement has the ends reversed. Adult human haemoglobin has four subunits, two of α type and two of β type, so the second statement is true.
Q41NEET 2023
Radial symmetry is NOT found in adults of phylum ______.
Not quite — the answer is A.
Hemichordates are bilaterally symmetrical worm-like animals. Coelenterates and ctenophores are radially symmetrical, and adult echinoderms are radially symmetrical too (their larvae are bilateral).
Q42NEET 2023
Which of the following statements are correct regarding female reproductive cycle? A. In non-primate mammals cyclical changes during reproduction are called oestrus cycle. B. First menstrual cycle begins at puberty and is called menopause. C. Lack of menstruation may be indicative of pregnancy. D. Cyclic menstruation extends between menarche and menopause. Choose the most appropriate answer from the options given below:
Not quite — the answer is C.
Cyclical reproductive changes in non-primate mammals are called the oestrus cycle, lack of menstruation may indicate pregnancy, and cyclic menstruation runs from menarche to menopause. The first menstruation at puberty is called menarche, not menopause.
Q43NEET 2023
Given below are two statements: one is labelled as Assertion A and the other is labelled as Reason R. Assertion A : Nephrons are of two types: Cortical & Juxta medullary, based on their relative position in cortex and medulla. Reason R : Juxta medullary nephrons have short loop of Henle whereas, cortical nephrons have longer loop of Henle. In the light of the above statements, choose the correct answer from the options given below :
Not quite — the answer is B.
Nephrons are classified as cortical and juxtamedullary by their position in the cortex and medulla, so the assertion is true. It is the juxtamedullary nephrons that have long loops of Henle dipping deep into the medulla, while cortical nephrons have short loops, so the reason is reversed and false.
Q44NEET 2023
Which of the following are NOT considered as the part of endomembrane system? A. Mitochondria B. Endoplasmic reticulum C. Chloroplasts D. Golgi complex E. Peroxisomes Choose the most appropriate answer from the options given below:
Not quite — the answer is A.
The endomembrane system includes the endoplasmic reticulum, Golgi complex, lysosomes and vacuoles, whose functions are coordinated. Mitochondria, chloroplasts and peroxisomes work independently of these and are not part of it.
Q45NEET 2023
Broad palm with single palm crease is visible in a person suffering from-
Not quite — the answer is D.
Down's syndrome (trisomy 21) is marked by a broad palm with a characteristic single palm crease, short stature, a furrowed tongue and partly open mouth. Turner's and Klinefelter's syndromes are sex chromosome disorders without this palm feature, and thalassemia is a blood disorder.
Q46NEET 2023
Match List I with List II. List I List II (A) P-wave (I) Beginning of systole (B) Q-wave (II) Repolarisation of ventricles (C) QRS complex (III) Depolarisation of atria (D) T-wave (IV) Depolarisation of ventricles Choose the correct answer from the options given below :
Not quite — the answer is D.
In the ECG the P-wave shows depolarisation of the atria, the QRS complex shows depolarisation of the ventricles, the T-wave shows repolarisation of the ventricles, and the Q-wave marks the beginning of systole. The trap is to match the T-wave with depolarisation.
Q47NEET 2023
Which one of the following common sexually transmitted diseases is completely curable when detected early and treated properly?
Not quite — the answer is A.
Gonorrhoea is caused by a bacterium and is completely curable when detected early and treated properly. Hepatitis-B, genital herpes and HIV infection are viral and are not completely curable.
Q48NEET 2023
Given below are two statements: one is labelled as Assertion A and the other is labelled as Reason R. Assertion A: Endometrium is necessary for implantation of blastocyst. Reason R: In the absence of fertilization, the corpus luteum degenerates that causes disintegration of endometrium. In the light of the above statements, choose the correct answer from the options given below:
Not quite — the answer is A.
The blastocyst gets embedded in the endometrium, so the endometrium is necessary for implantation. Without fertilisation the corpus luteum degenerates and the endometrium disintegrates, which is also true but explains menstruation, not why implantation needs the endometrium.
Q49NEET 2023
Which of the following is not a cloning vector?
Not quite — the answer is C.
A probe is a labelled single-stranded piece of DNA or RNA used to detect a complementary sequence, not a vehicle for carrying DNA. YAC, BAC and the plasmid pBR322 are all cloning vectors.
Q50NEET 2023
Match List I with List II. List I List II (A) Taenia (I) Nephridia (B) Paramoecium (II) Contractile vacuole (C) Periplaneta (III) Flame cells (D) Pheretima (IV) Urecose gland Choose the correct answer from the options given below :
Not quite — the answer is B.
Taenia (a flatworm) excretes through flame cells, Paramoecium removes water through its contractile vacuole, Periplaneta has urecose glands, and Pheretima excretes through nephridia. The trap is to give nephridia to Taenia.
Q51NEET 2023
Given below are two statements: Statement I : Ligaments are dense irregular tissue. Statement II : Cartilage is dense regular tissue. In the light of the above statements, choose the correct answer from the options given below:
Not quite — the answer is A.
Tendons and ligaments are dense regular connective tissue with parallel collagen fibres, so the first statement is false. Cartilage is a specialised connective tissue, not dense regular tissue, so the second statement is also false.
Q52NEET 2023
Which of the following functions is carried out by cytoskeleton in a cell?
Not quite — the answer is B.
The cytoskeleton of microtubules, microfilaments and intermediate filaments gives mechanical support, helps in motility and maintains cell shape. Protein synthesis is done by ribosomes, not the cytoskeleton.
Q53NEET 2023
Match List I with List II. List I List II (A) Gene 'a' (I) β-galactosidase (B) Gene 'y' (II) Transacetylase (C) Gene 'i' (III) Permease (D) Gene 'z' (IV) Repressor protein Choose the correct answer from the options given below :
Not quite — the answer is A.
In the lac operon the i gene codes for the repressor, z for β-galactosidase, y for permease and a for transacetylase. The common trap is to swap the y and a gene products.
Q54NEET 2023
Which one of the following techniques does not serve the purpose of early diagnosis of a disease for its early treatment?
Not quite — the answer is A.
With conventional methods such as serum and urine analysis a disease cannot be detected early, because the pathogen must already be present in large numbers. Recombinant DNA technology, PCR and ELISA can detect very small amounts of the pathogen or its products and so allow early diagnosis.
Q55NEET 2023
Given below are two statements : Statement I : Low temperature preserves the enzyme in a temporarily inactive state whereas high temperature destroys enzymatic activity because proteins are denatured by heat. Statement II : When the inhibitor closely resembles the substrate in its molecular structure and inhibits the activity of the enzyme, it is known as competitive inhibitor. In the light of the above statements, choose the correct answer from the options given below:
Not quite — the answer is D.
Low temperature keeps an enzyme temporarily inactive while high temperature denatures the protein and destroys its activity, so the first statement is true. An inhibitor that closely resembles the substrate and competes for the active site is a competitive inhibitor, so the second statement is true too.
Q56NEET 2023
Match List I with List II. List I (Type of Joint) – List II (Found between) (A) Cartilaginous Joint (I) Between flat skull bones (B) Ball and Socket Joint (II) Between adjacent vertebrae in vertebral column (C) Fibrous Joint (III) Between carpal and metacarpal of thumb (D) Saddle joint (IV) Between Humerus and Pectoral girdle Choose the correct answer from the options given below:
Not quite — the answer is A.
Cartilaginous joints occur between adjacent vertebrae, the ball and socket joint between the humerus and pectoral girdle, fibrous joints between the flat skull bones, and the saddle joint between the carpal and metacarpal of the thumb. The trap is to call the skull joints saddle joints.
Q57NEET 2023
Given below are two statements: Statement I: Vas deferens receives a duct from seminal vesicle and opens into urethra as the ejaculatory duct. Statement II: The cavity of the cervix is called cervical canal which along with vagina forms birth canal. In the light of the above statements, choose the correct answer from the options given below:
Not quite — the answer is D.
Each vas deferens receives a duct from the seminal vesicle and opens into the urethra as the ejaculatory duct. The cavity of the cervix is the cervical canal, which together with the vagina forms the birth canal, so both statements are true.
Q58NEET 2023
In which blood corpuscles, the HIV undergoes replication and produces progeny viruses?
Not quite — the answer is D.
After entering the body HIV infects macrophages and then helper T-lymphocytes (TH cells), where it replicates and releases progeny viruses, steadily lowering the TH cell count. B-lymphocytes, basophils and eosinophils are not its replication sites.
Q59NEET 2023
Match List I with List II. List I List II (A) Heroin (I) Effect on cardiovascular system (B) Marijuana (II) Slow down body function (C) Cocaine (III) Painkiller (D) Morphine (IV) Interfere with transport of dopamine Choose the correct answer from the options given below:
Not quite — the answer is D.
Heroin is a depressant that slows down body functions, marijuana (cannabinoids) affects the cardiovascular system, cocaine interferes with the transport of dopamine, and morphine is an effective painkiller. The trap is to call heroin the painkiller and morphine the depressant.
Q60NEET 2023
Vital capacity of lung is ________.
Not quite — the answer is C.
Vital capacity is the maximum air that can be breathed out after a forced inspiration, which is ERV + TV + IRV. Adding residual volume gives total lung capacity, and IRV + ERV alone leaves out the tidal volume.
Q61NEET 2023
Select the correct group/set of Australian Marsupials exhibiting adaptive radiation.
Not quite — the answer is A.
The numbat (banded anteater), spotted cuscus and flying phalanger are all Australian marsupials that arose by adaptive radiation from a common ancestor. The mole, flying squirrel, lemur, anteater, wolf and bobcat are placental mammals.
Q62NEET 2023
Given below are two statements: one is labelled as Assertion A and other is labelled as Reason R. Assertion A : Amniocentesis for sex determination is one of the strategies of Reproductive and Child Health Care Programme. Reason R : Ban on amniocentesis checks increasing menace of female foeticide. In the light of the above statements, choose the correct answer from the options given below.
Not quite — the answer is C.
Amniocentesis for sex determination is not a strategy of the RCH programme; a statutory ban on it is the strategy, so the assertion is false. The ban checks the increasing menace of female foeticide, so the reason is true.
Q63NEET 2023
Given below are two statements: Statement I: RNA mutates at a faster rate. Statement II: Viruses having RNA genome and shorter life span mutate and evolve faster. In the light of the above statements, choose the correct answer from the options given below:
Not quite — the answer is D.
RNA is less stable chemically than DNA and mutates at a faster rate. So viruses with an RNA genome and a short life span mutate and evolve faster, and both statements are true.
Q64NEET 2023
Match List I with List II. List I List II (A) Vasectomy (I) Oral method (B) Coitus interruptus (II) Barrier method (C) Cervical caps (III) Surgical method (D) Saheli (IV) Natural method Choose the correct answer from the options given below:
Not quite — the answer is A.
Vasectomy is a surgical method, coitus interruptus is a natural method, cervical caps are a barrier method, and Saheli is an oral contraceptive pill. The trap is to call cervical caps an oral method.
Q65NEET 2023
Given below are two statements: Statement I: In prokaryotes, the positively charged DNA is held with some negatively charged proteins in a region called nucleoid. Statement II: In eukaryotes, the negatively charged DNA is wrapped around the positively charged histone octamer to form nucleosome. In the light of the above statements, choose the correct answer from the options given below:
Not quite — the answer is C.
DNA is negatively charged because of its phosphate groups, so in prokaryotes it is held with some positively charged proteins in the nucleoid; the first statement has the charges reversed. In eukaryotes the negatively charged DNA wraps around the positively charged histone octamer to form a nucleosome, so the second statement is correct.
Q66NEET 2023
Match List I with List II. List I List II (A) Ringworm (I) Haemophilus influenzae (B) Filariasis (II) Trichophyton (C) Malaria (III) Wuchereria bancrofti (D) Pneumonia (IV) Plasmodium vivax Choose the correct answer from the options given below:
Not quite — the answer is D.
Ringworm is caused by fungi such as Trichophyton, filariasis by Wuchereria bancrofti, malaria by Plasmodium vivax, and pneumonia by Haemophilus influenzae. The trap is to swap the malaria and pneumonia pathogens.
Q67NEET 2023
Match List I with List II. List I (Interacting species) – List II (Name of interaction) (A) A Leopard and a Lion in a forest/grassland (I) Competition (B) A Cuckoo laying egg in a Crow's nest (II) Brood parasitism (C) Fungi and root of a higher plant in Mycorrhizae (III) Mutualism (D) A cattle egret and a Cattle in a field (IV) Commensalism Choose the correct answer from the options given below.
Not quite — the answer is D.
A leopard and a lion in the same area compete for prey, a cuckoo laying eggs in a crow's nest is brood parasitism, fungi with plant roots in mycorrhizae are mutualism, and the cattle egret feeding on insects disturbed by grazing cattle is commensalism. The trap is to swap mutualism and commensalism.
Q68NEET 2023
Which of the following statements are correct? A. Basophils are most abundant cells of the total WBCs B. Basophils secrete histamine, serotonin and heparin C. Basophils are involved in inflammatory response D. Basophils have kidney shaped nucleus E. Basophils are agranulocytes Choose the correct answer from the options given below:
Not quite — the answer is B.
Basophils secrete histamine, serotonin and heparin and are involved in inflammatory reactions. They are the least abundant WBCs, have a lobed (not kidney-shaped) nucleus and are granulocytes, so the other statements are wrong.
Q69NEET 2023
Match List I with List II. List I List II (A) Mast cells (I) Ciliated epithelium (B) Inner surface of bronchiole (II) Areolar connective tissue (C) Blood (III) Cuboidal epithelium (D) Tubular parts of nephron (IV) Specialised connective tissue Choose the correct answer from the options given below:
Not quite — the answer is B.
Mast cells are found in areolar connective tissue, the inner surface of bronchioles is lined by ciliated epithelium, blood is a specialised connective tissue, and the tubular parts of the nephron are lined by cuboidal epithelium. The trap is to link blood with areolar tissue.
Q70NEET 2023
Select the correct statements. A. Tetrad formation is seen during Leptotene. B. During Anaphase, the centromeres split and chromatids separate. C. Terminalization takes place during Pachytene. D. Nucleolus, Golgi complex and ER are reformed during Telophase. E. Crossing over takes place between sister chromatids of homologous chromosome. Choose the correct answer from the options given below:
Not quite — the answer is A.
In anaphase the centromeres split and chromatids separate, and in telophase the nucleolus, Golgi complex and ER reform, so these two are correct. Tetrads (bivalents) are seen in zygotene–pachytene, not leptotene; terminalisation occurs in diakinesis; and crossing over is between non-sister chromatids.
Q71NEET 2023
In cockroach, excretion is brought about by - A. Phallic gland B. Urecose gland C. Nephrocytes D. Fat body E. Collaterial glands Choose the correct answer from the options given below :
Not quite — the answer is B.
In cockroach, excretion is by Malpighian tubules helped by the fat body, nephrocytes and urecose (uricose) glands. Phallic and collaterial glands are reproductive glands, not excretory.
Q72NEET 2023
Given below are two statements: Statement I : During G₀ phase of cell cycle, the cell is metabolically inactive. Statement II : The centrosome undergoes duplication during S phase of interphase. In the light of the above statements, choose the most appropriate answer from the options given below:
Not quite — the answer is C.
Cells in the G₀ (quiescent) phase remain metabolically active but do not proliferate, so the first statement is incorrect. In animal cells the centriole/centrosome duplicates in the cytoplasm during the S phase, so the second statement is correct.
Q73NEET 2023
Select the correct statements with reference to chordates. A. Presence of a mid-dorsal, solid and double nerve cord. B. Presence of closed circulatory system. C. Presence of paired pharyngeal gill slits. D. Presence of dorsal heart E. Triploblastic pseudocoelomate animals. Choose the correct answer from the options given below:
Not quite — the answer is A.
Chordates have a closed circulatory system and paired pharyngeal gill slits. Their nerve cord is dorsal, hollow and single, their heart is ventral, and they are triploblastic coelomates, so those statements are wrong.
Q74NEET 2023
Match List I with List II. List I List II (A) Logistic growth (I) Unlimited resource availability condition (B) Exponential growth (II) Limited resource availability condition (C) Expanding age pyramid (III) The percent individuals of pre-reproductive age is largest followed by reproductive and post reproductive age groups (D) Stable age pyramid (IV) The percent individuals of pre-reproductive and reproductive age group are same Choose the correct answer from the options given below:
Not quite — the answer is D.
Logistic growth occurs when resources are limited and exponential growth when they are unlimited. An expanding age pyramid has the largest share of pre-reproductive individuals, followed by reproductive and post-reproductive ones, while a stable pyramid has similar shares of pre-reproductive and reproductive individuals.
Q75NEET 2023
Which one of the following is the sequence on corresponding coding strand, if the sequence on mRNA formed is as follows 5’AUCGAUCGAUCGAUCGAUCGAUCGAUCG 3’?
Not quite — the answer is B.
The coding strand has the same sequence and polarity as the mRNA except that thymine replaces uracil, so it reads 5' ATCGATCGATCGATCGATCGATCGATCG 3'. A strand written 3'→5' with ATCG is the wrong polarity, and sequences with U are RNA, not a DNA strand.
Q76NEET 2023
Which of the following is characteristic feature of cockroach regarding sexual dimorphism?
Not quite — the answer is A.
In cockroach a pair of short, thread-like anal styles is present only in males, so it is a sexually dimorphic feature. Anal cerci and sclerites occur in both sexes, and body colour does not differ between them.
Q77NEET 2023
Which of the following statements are correct regarding skeletal muscle? A. Muscle bundles are held together by collagenous connective tissue layer called fascicle. B. Sarcoplasmic reticulum of muscle fibre is a store house of calcium ions. C. Striated appearance of skeletal muscle fibre is due to distribution pattern of actin and myosin proteins. D. M line is considered as functional unit of contraction called sarcomere. Choose the most appropriate answer from the options given below:
Not quite — the answer is A.
The sarcoplasmic reticulum stores calcium ions, and the striated appearance comes from the distribution pattern of actin and myosin. Muscle bundles (fascicles) are held together by a collagenous layer called fascia, not fascicle, and the sarcomere is the part between two Z lines, not the M line.
Q78NEET 2023
The unique mammalian characteristics are :
Not quite — the answer is A.
Hair on the skin, external ears (pinnae) and milk-producing mammary glands are the characteristics unique to mammals. A tympanic membrane is also found in frogs, reptiles and birds, mammals have a dicondylic skull, and their development is direct.
Q79NEET 2023
The parts of human brain that helps in regulation of sexual behaviour, expression of excitement, pleasure, rage, fear etc. are:
Not quite — the answer is D.
The limbic system (amygdala, hippocampus and related parts) together with the hypothalamus regulates sexual behaviour and the expression of emotional reactions such as excitement, pleasure, rage and fear. Corpora quadrigemina and the corpus callosum have other functions.
Q80NEET 2023
Which of the following statements are correct? A. An excessive loss of body fluid from the body switches off osmoreceptors. B. ADH facilitates water reabsorption to prevent diuresis. C. ANF causes vasodilation. D. ADH causes increase in blood pressure. E. ADH is responsible for decrease in GFR. Choose the correct answer from the options given below:
Not quite — the answer is A.
ADH promotes water reabsorption and prevents diuresis, ANF causes vasodilation, and ADH's constrictory effect on blood vessels raises blood pressure. An excessive loss of body fluid activates, not switches off, the osmoreceptors, and the rise in blood pressure from ADH increases rather than decreases GFR.
Q81NEET 2023
Which of the following are NOT under the control of thyroid hormone? A. Maintenance of water and electrolyte balance B. Regulation of basal metabolic rate C. Normal rhythm of sleep-wake cycle D. Development of immune system E. Support the process of RBCs formation Choose the correct answer from the options given below:
Not quite — the answer is B.
Thyroid hormones regulate basal metabolic rate, support RBC formation and help maintain water and electrolyte balance. The sleep-wake rhythm is regulated by melatonin from the pineal gland, and development of the immune system is supported by thymosins from the thymus, so these are not under thyroid control.
Q82NEET 2023
Axile placentation is observed in
Not quite — the answer is C.
In axile placentation the placenta is axial and ovules are attached to it in a multilocular ovary, as in China rose, tomato, lemon and Petunia (Solanaceae). Beans and lupin have marginal placentation, Dianthus has free central placentation, and mustard has parietal placentation.
Q83NEET 2023
Match List I with List II. List I List II (A) CCK (I) Kidney (B) GIP (II) Heart (C) ANF (III) Gastric gland (D) ADH (IV) Pancreas Choose the correct answer from the options given below :
Not quite — the answer is D.
CCK acts on the pancreas and gall bladder, GIP inhibits gastric secretion and motility, ANF is secreted by the heart, and ADH acts on the kidney. The trap is to pair GIP with the heart.
Biology: not in the current NEET syllabus
These 14 questions are from topics NCERT dropped in its 2023 revision. Shown for completeness; you can skip them for NEET 2027.
14 questions. Tap an option to check your answer.
Q1NEET 2023
Given below are two statements : One is labelled as Assertion A and the other is labelled as Reason R : Assertion A : Late wood has fewer xylary elements with narrow vessels. Reason R : Cambium is less active in winters. In the light of the above statements, choose the correct answer from the options given below :
Not quite — the answer is D.
In winter the cambium is less active and forms late (autumn) wood, which has fewer xylary elements with narrow vessels; in spring the more active cambium forms early wood with wide vessels. So the assertion is true and the reduced cambial activity in winter is exactly why late wood is like this.
Q2NEET 2023
Movement and accumulation of ions across a membrane against their concentration gradient can be explained by
Not quite — the answer is C.
Moving ions against their concentration gradient needs energy from ATP and carrier proteins (pumps), which is active transport. Facilitated diffusion, passive transport and osmosis all move substances only down a gradient.
Q3NEET 2023
The thickness of ozone in a column of air in the atmosphere is measured in terms of :
Not quite — the answer is D.
The thickness of ozone in a column of air from the ground to the top of the atmosphere is measured in Dobson units (DU). Decibels measure sound intensity and kilobase measures DNA length.
Q4NEET 2023
Which micronutrient is required for splitting of water molecule during photosynthesis?
Not quite — the answer is D.
Manganese activates the enzymes of photolysis and is needed for splitting water to release oxygen during photosynthesis. Magnesium is in chlorophyll, molybdenum is in nitrogenase and nitrate reductase, and copper is in plastocyanin, but none of them splits water.
Q5NEET 2023
Given below are two statements : Statement I : The forces generated by transpiration can lift a xylem-sized column of water over 130 meters height. Statement II : Transpiration cools leaf surfaces sometimes 10 to 15 degrees by evaporative cooling. In the light of the above statements, choose the most appropriate answer from the options given below :
Not quite — the answer is D.
Transpiration pull can create enough force to lift a xylem-sized column of water over 130 metres. Transpiration also cools leaf surfaces, sometimes by 10 to 15 degrees, through evaporative cooling, so both statements are correct.
Q6NEET 2023
Identify the correct statements: A. Lenticels are the lens-shaped openings permitting the exchange of gases. B. Bark formed early in the season is called hard bark. C. Bark is a technical term that refers to all tissues exterior to vascular cambium. D. Bark refers to periderm and secondary phloem. E. Phellogen is single-layered in thickness. Choose the correct answer from the options given below:
Not quite — the answer is A.
Lenticels are lens-shaped openings in the bark that allow exchange of gases, and bark refers to the periderm plus the secondary phloem, so these two are correct. Bark formed early in the season is soft (early) bark, bark is a non-technical term rather than a technical one, and phellogen is a couple of layers thick, not single-layered.
Q7NEET 2023
Match List I with List II : List I List II (A) Cohesion (I) More attraction in liquid phase (B) Adhesion (II) Mutual attraction among water molecules (C) Surface tension (III) Water loss in liquid phase (D) Guttation (IV) Attraction towards polar surfaces Choose the correct answer from the options given below :
Not quite — the answer is D.
Cohesion is the mutual attraction among water molecules, adhesion is attraction to polar surfaces, surface tension comes from water molecules attracting each other more in the liquid phase than in the gas phase, and guttation is water loss in liquid form. The trap is to swap cohesion and adhesion.
Q8NEET 2023
Which one of the following statements is NOT correct?
Not quite — the answer is A.
Algal blooms from excess nutrients spoil water quality and kill fish, so saying they improve water quality and promote fisheries is not correct. Water hyacinth thriving in eutrophic water, biomagnification of toxic substances and oxygen depletion by microbes decomposing sewage are all correct statements.
Q9NEET 2023
Match List I with List II: List I List II (A) Iron (I) Synthesis of auxin (B) Zinc (II) Component of nitrate reductase (C) Boron (III) Activator of catalase (D) Molybdenum (IV) Cell elongation and differentiation Choose the correct answer from the options given below:
Not quite — the answer is B.
Iron activates catalase, zinc is needed for the synthesis of auxin, boron is required for cell elongation and differentiation, and molybdenum is a component of nitrate reductase. The trap is to give iron the nitrate reductase role.
Q10NEET 2023
Match List I with List II with respect to human eye. List I List II (A) Fovea (I) Visible coloured portion of eye that regulates diameter of pupil. (B) Iris (II) External layer of eye formed of dense connective tissue. (C) Blind spot (III) Point of greatest visual acuity or resolution. (D) Sclera (IV) Point where optic nerve leaves the eyeball and photoreceptor cells are absent. Choose the correct answer from the options given below:
Not quite — the answer is D.
The fovea is the point of greatest visual acuity, the iris is the visible coloured part that regulates pupil diameter, the blind spot is where the optic nerve leaves the eye and there are no photoreceptors, and the sclera is the outer layer of dense connective tissue. The trap is to swap the fovea and the blind spot.
Q11NEET 2023
Match List I with List II List I (Cells) – List II (Secretion) (A) Peptic cells (I) Mucus (B) Goblet cells (II) Bile juice (C) Oxyntic cells (III) Proenzyme pepsinogen (D) Hepatic cells (IV) HCl and intrinsic factor for absorption of vitamin B₁₂ Choose the correct answer from the options given below:
Not quite — the answer is B.
Peptic (chief) cells secrete the proenzyme pepsinogen, goblet cells secrete mucus, oxyntic (parietal) cells secrete HCl and intrinsic factor needed to absorb vitamin B₁₂, and hepatic cells secrete bile. The trap is to give peptic cells the HCl.
Q12NEET 2023
Which of the following statements is correct?
Not quite — the answer is A.
Biomagnification is the increase in concentration of a toxicant at successive trophic levels. A large amount of nutrients promotes rather than restricts algal blooms, blooms increase fish mortality, and eutrophication is the natural ageing and nutrient enrichment of a lake, not merely an increase in sewage.
Q13NEET 2023
Once the undigested and unabsorbed substances enter the caecum, their backflow is prevented by
Not quite — the answer is A.
The ileo-caecal valve at the junction of the ileum and caecum prevents backflow of the undigested material into the ileum. The gastro-oesophageal sphincter and pyloric sphincter guard the stomach, and the sphincter of Oddi guards the common hepato-pancreatic duct.
Q14NEET 2023
Given below are two statements: Statement I: Electrostatic precipitator is most widely used in thermal power plant. Statement II : Electrostatic precipitator in thermal power plant removes ionising radiations. In the light of the above statements, choose the most appropriate answer from the options given below:
Not quite — the answer is B.
The electrostatic precipitator is the most widely used device for removing particulate matter from thermal power plant exhaust, so the first statement is correct. It removes particulate matter, not ionising radiation, so the second statement is incorrect.
Chapter-wise split of NEET 2023 Biology
- Cell Cycle and Cell Division6 Q
- Molecular Basis of Inheritance6 Q
- Principles of Inheritance and Variation4 Q
- Sexual Reproduction in Flowering Plants4 Q
- Biotechnology: Principles and Processes4 Q
- Biomolecules4 Q
- Organisms and Populations4 Q
- Animal Kingdom4 Q
- Structural Organisation in Animals4 Q
- Morphology of Flowering Plants3 Q
- Plant Growth and Development3 Q
- Photosynthesis in Higher Plants3 Q
- Cell: The Unit of Life3 Q
- Human Reproduction3 Q
- Reproductive Health3 Q
- Human Health and Disease3 Q
- Biodiversity and Conservation2 Q
- Plant Kingdom2 Q
- Ecosystem2 Q
- Respiration in Plants2 Q
- Excretory Products and Their Elimination2 Q
- Body Fluids and Circulation2 Q
- Locomotion and Movement2 Q
- Evolution2 Q
- Chemical Coordination and Integration2 Q
- Anatomy of Flowering Plants1 Q
- Biotechnology and Its Applications1 Q
- Breathing and Exchange of Gases1 Q
- Neural Control and Coordination1 Q
About this paper
How many questions from NEET 2023 are on this page?
179 questions (Physics 40, Chemistry 42, Biology 97). Questions that need a diagram we could not reproduce, or whose wording in the source was unclear, are left out.
Are these the original questions?
Yes. The questions and options are as set in the NEET 2023 paper, conducted by NTA. The answer to every question was checked by the RankUp team, and the explanations are RankUp's own.
Is NEET 2023 useful for NEET 2027?
Yes. The NEET syllabus is built on the same NCERT books. 24 questions here are on topics NCERT has since dropped; they are listed separately so you can skip them.
More NEET and AIPMT papers
Practise thousands more questions chapter-wise in the RankUp app.
- NEET 2026 Re-exam
- NEET 2026 (3 May, cancelled)
- NEET 2025
- NEET 2024 Re-exam
- NEET 2024
- NEET 2023 Manipur
- NEET 2022
- NEET 2021
- NEET 2020
- NEET 2019
- NEET 2018
- NEET 2017
- NEET 2017 (Gujarati paper)
- NEET 2016 Phase 2
- NEET 2016 Phase 1
- AIPMT 2015
- AIPMT 2014
- NEET 2013
- AIPMT 2012 Mains
- AIPMT 2012 Prelims
- AIPMT 2011 Mains
- AIPMT 2011 Prelims
- AIPMT 2010 Mains
- AIPMT 2010 Prelims
- AIPMT 2009 Prelims
- AIPMT 2008 Prelims
- AIPMT 2007 Prelims
- AIPMT 2006 Prelims
- AIPMT 2005 Prelims
- All NEET PYQs
